video tracking system (TSE systems)
TSE systems is a verified supplier 
TSE systems manufactures this product 
94
Structured Review
TSE systems
video tracking system
Video Tracking System, supplied by TSE systems, used in various techniques. Bioz Stars score: 94/100, based on 286 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/video+tracking+system+videomot2/VideoMot2/pm41898673-218-1-23
Average 94 stars, based on 286 article reviews
Video Tracking System, supplied by TSE systems, used in various techniques. Bioz Stars score: 94/100, based on 286 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/video+tracking+system+videomot2/VideoMot2/pm41898673-218-1-23
Average 94 stars, based on 286 article reviews
video tracking system - by Bioz Stars,
2026-09
94/100 stars
Images
Related Articles
other:Article Title: Differential chronic social stress models in male and female mice. Article Snippet: Edited by: Carmen Sandi Abstract Chronic stress creates an allostatic overload that may lead to mood disorders such as anxiety and depression.. Modern causes of chronic stress in humans are mostly social in nature, relating to work and relationship stress.. Research into neural and molecular mechanisms of vulnerability and resilience following chronic social stress (CSS) is ongoing and uses animal models to discover efficient prevention strategies and treatments. Article Title: Micro-RNAS and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions Article Snippet: TABLE 8 Oligonucleotide primers used for microRNA real time PCR Gene Primer sequence miR-135a TATGGCTTTTTATTCCTATGTGA (SEQ ID NO: 1) miR-135b TATGGCTTTTCATTCCTATGTGA (SEQ ID NO: 2) miR-375 TTTGTTCGTTCGGCTCGCGTGA (SEQ ID NO: 3) U6 GATGACACGCAAATTCGTGAA (SEQ ID NO: 4) miR-124 TAAGGCACGCGGTGAATGCC (SEQ ID NO: 5) miR-16 TAGCAGCACGTAAATATTGGCG (SEQ ID NO: 158) TABLE 9 Oligonucleotide primers used for mRNA real time PCR Gene Sense Primer Antisense Primer Slc6a4 GGGTTTGGATAGTACGTTCGCA CATACGCCCCTCCTGATGTC (SEQ ID NO: 159) (SEQ ID NO: 160) Htr1a GTGCACCATCAGCAAGGACC GCGCCGAAAGTGGAGTAGAT (SEQ ID NO: 161) (SEQ ID NO: 162) Tph2 AGTATTTTGTGGATGTGGCCATG TGGGAATGGGCTGACCATATT (SE QID NO: 163) (SEQ ID NO: 164) YFP CATGCCCGAAGGCTACGT CGATGCCCTTCAGCTCGAT (SEQ ID NO: 165) (SEQ ID NO: 166) GAD-67 TCATGTCCCGGAAGCACC AATTGGCCCTTTCTATGCCG (SEQ ID NO: 167) (SEQ ID NO: 168) Cloning of miR-135 Knockdown Lentiviral Constructs, Production of Lentiviruses and In Vitro Verifications miR-135 knockdown (KD) plasmid pEZX-H1-miR-135KD-CMV-mCherry and control pEZX-H1-control KD-CMV-mCherry were purchased from GeneCopeia (USA). Article Title: Intranasal metformin treatment ameliorates cognitive functions via insulin signaling pathway in ICV-STZ-induced mice model of Alzheimer's disease. Article Snippet: Aims: The relationship between type 2 diabetes and Alzheimer's disease (AD) provides evidence that insulin and insulin sensitizers may be beneficial for the treatment of AD.. The present study investigated the effect and mechanism of action of intranasal metformin treatment on impaired cognitive functions in an experimental mice Article Title: The Effect of a Diet Enriched with Jerusalem artichoke , Inulin, and Fluoxetine on Cognitive Functions, Neurogenesis, and the Composition of the Intestinal Microbiota in Mice. Article Snippet: The course of the Article Title: The Effect of a Diet Enriched with Jerusalem artichoke , Inulin, and Fluoxetine on Cognitive Functions, Neurogenesis, and the Composition of the Intestinal Microbiota in Mice Article Snippet: The course of the Mouse Assay:Article Title: Micro-RNAS and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions Article Snippet: Samples were then analyzed using SYBRGreen PCR kit (Qiagen) according to the manufacturer's guidelines in AB 7500 thermocycler (Applied Biosystems). .. Mice locomotion in the box was quantified using a |