Review



video tracking system  (TSE systems)


Bioz Verified Symbol TSE systems is a verified supplier
Bioz Manufacturer Symbol TSE systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    TSE systems video tracking system
    Video Tracking System, supplied by TSE systems, used in various techniques. Bioz Stars score: 94/100, based on 286 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/video+tracking+system+videomot2/VideoMot2/pm41898673-218-1-23
    Average 94 stars, based on 286 article reviews
    video tracking system - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    other:

    Article Title: Differential chronic social stress models in male and female mice.
    Article Snippet: Edited by: Carmen Sandi Abstract Chronic stress creates an allostatic overload that may lead to mood disorders such as anxiety and depression.. Modern causes of chronic stress in humans are mostly social in nature, relating to work and relationship stress.. Research into neural and molecular mechanisms of vulnerability and resilience following chronic social stress (CSS) is ongoing and uses animal models to discover efficient prevention strategies and treatments.

    Article Title: Micro-RNAS and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions
    Article Snippet: TABLE 8 Oligonucleotide primers used for microRNA real time PCR Gene Primer sequence miR-135a TATGGCTTTTTATTCCTATGTGA (SEQ ID NO: 1) miR-135b TATGGCTTTTCATTCCTATGTGA (SEQ ID NO: 2) miR-375 TTTGTTCGTTCGGCTCGCGTGA (SEQ ID NO: 3) U6 GATGACACGCAAATTCGTGAA (SEQ ID NO: 4) miR-124 TAAGGCACGCGGTGAATGCC (SEQ ID NO: 5) miR-16 TAGCAGCACGTAAATATTGGCG (SEQ ID NO: 158) TABLE 9 Oligonucleotide primers used for mRNA real time PCR Gene Sense Primer Antisense Primer Slc6a4 GGGTTTGGATAGTACGTTCGCA CATACGCCCCTCCTGATGTC (SEQ ID NO: 159) (SEQ ID NO: 160) Htr1a GTGCACCATCAGCAAGGACC GCGCCGAAAGTGGAGTAGAT (SEQ ID NO: 161) (SEQ ID NO: 162) Tph2 AGTATTTTGTGGATGTGGCCATG TGGGAATGGGCTGACCATATT (SE QID NO: 163) (SEQ ID NO: 164) YFP CATGCCCGAAGGCTACGT CGATGCCCTTCAGCTCGAT (SEQ ID NO: 165) (SEQ ID NO: 166) GAD-67 TCATGTCCCGGAAGCACC AATTGGCCCTTTCTATGCCG (SEQ ID NO: 167) (SEQ ID NO: 168) Cloning of miR-135 Knockdown Lentiviral Constructs, Production of Lentiviruses and In Vitro Verifications miR-135 knockdown (KD) plasmid pEZX-H1-miR-135KD-CMV-mCherry and control pEZX-H1-control KD-CMV-mCherry were purchased from GeneCopeia (USA).

    Article Title: Intranasal metformin treatment ameliorates cognitive functions via insulin signaling pathway in ICV-STZ-induced mice model of Alzheimer's disease.
    Article Snippet: Aims: The relationship between type 2 diabetes and Alzheimer's disease (AD) provides evidence that insulin and insulin sensitizers may be beneficial for the treatment of AD.. The present study investigated the effect and mechanism of action of intranasal metformin treatment on impaired cognitive functions in an experimental mice

    Article Title: The Effect of a Diet Enriched with Jerusalem artichoke , Inulin, and Fluoxetine on Cognitive Functions, Neurogenesis, and the Composition of the Intestinal Microbiota in Mice.
    Article Snippet: The course of the video tracking system VideoMot2 (TSE Systems, Berlin, Germany) and three parameters were measured: escape latency (the average time needed to find the platform), distance (the average distance traveled in order to find the platform), and time spent in the W-channel.

    Article Title: The Effect of a Diet Enriched with Jerusalem artichoke , Inulin, and Fluoxetine on Cognitive Functions, Neurogenesis, and the Composition of the Intestinal Microbiota in Mice
    Article Snippet: The course of the video tracking system VideoMot2 (TSE Systems, Berlin, Germany) and three parameters were measured: escape latency (the average time needed to find the platform), distance (the average distance traveled in order to find the platform), and time spent in the W-channel.

    Mouse Assay:

    Article Title: Micro-RNAS and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions
    Article Snippet: Samples were then analyzed using SYBRGreen PCR kit (Qiagen) according to the manufacturer's guidelines in AB 7500 thermocycler (Applied Biosystems). .. Mice locomotion in the box was quantified using a video tracking system (VideoMot2; TSE Systems, Bad Hamburg, Germany). ..



    Similar Products

    94
    TSE systems video tracking system
    Video Tracking System, supplied by TSE systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/video+tracking+system+videomot2/VideoMot2/pm41898673-218-1-23
    Average 94 stars, based on 1 article reviews
    video tracking system - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    90
    TSE systems camera equipped with a video tracking system videomot2 bwm
    Camera Equipped With A Video Tracking System Videomot2 Bwm, supplied by TSE systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/video+tracking+system+videomot2/videomot2+software/pm39952542-65-6-15
    Average 90 stars, based on 1 article reviews
    camera equipped with a video tracking system videomot2 bwm - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    94
    TSE systems tse videomot2 video tracking system
    Tse Videomot2 Video Tracking System, supplied by TSE systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/video+tracking+system+videomot2/VideoMot2/pm38997102-101-30-35
    Average 94 stars, based on 1 article reviews
    tse videomot2 video tracking system - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    Image Search Results